Introduction

Pseudomonas aeruginosa is considered to be classified as an opportunistic pathogen. Hospitalized and catheterized patients and those who are kept in intensive care units or suffering from severe burns or illness are mostly pretentious by this organism (Yetkin, Otlu, Cicek, Kuzucu, & Durmaz, 2006). The capability of P.aeruginosa to live with the fewest nutritional conditions has given it an opportunity to withstand a lot of different physical parameters in hospital and society settings (Lister, Wolter, & Hanson, 2009). All of the antibiotics to reach their targets have to pass through the cell wall. The inability of antibiotics to gather in P.aeruginosa is mainly because of the efflux pumps that lead to the deficient in the permeability of the outer membrane and the powerful removal transfer of antibiotic molecules. Quinolones and β-lactams have only the ability to pass through the outer membrane via the channels given by porin proteins because they are small hydrophilic molecules (Dinesh, Grundmann, Pitt, & Römling, 2003). P.aeruginosa has 163 familiar or estimated porin proteins lied on its genome sequence, in which 64 ones are placed as part of 3 families of porins the TonB-dependent gated porin family, the OprD-specific porin family and the OprM efflux family. The most popular channel in P.aeruginosa for big substrates is known to be OprF, the resistance to imipenem and meropenem is not influenced by the removal of OprD (Davies & Bilton, 2009). The intrinsic resis­tance of P.aeruginosa to different antibiotics and its capability to create multidrug and mutational acquired resis­tance to antibiotics via chromosomal mutations causes an extreme therapeutic problems (Gales, Jones, Turnidge, Rennie, & Ramphal, 2001; Paterson & Bonomo, 2005). Peptidoglycan­ assembling transpeptidases are slowed down by the β-lactams, which is present in the external face of the cytoplasmic membrane. Part of β-lactams has the ability to be active against P.aeruginosa and sometimes extended spectrum penicillins prescribed in the treatment of this infection (Ayalew, Nambiar, Yasinskaya, & Jantausch, 2003). Carbapenems are sorted as a class of broad-spectrum β-lactam antibiotics, while meropenem has a moderately higher effect on P.aeruginosa (Ayalew et al., 2003; Baldwin, Lyseng-Williamson, & Keam, 2008; Shah & Narang, 2005). The aminoglycosides have been advised to be used in the treatment of these infections and their mechanism of working is by suppressing the protein synthesis through binding to the 30S subunit of the ribosome (Hauser & Sriram, 2005).

The difficulties for the sensitivity of microbial identification methods is due to P.aeruginosa adaptive ability and it is very important to develop systems with the ability to identify these bacteria since it has become necessary to develop genotype based characterization systems capable of accurately identifying these bacteria instead of any phenol-typic modifications, the molecular identification has finished the problem of different phenotype and allows for more accurate identification of bacteria (Drancourt et al., 2000). Heteroresistance is a type of resistance that seems to be a transitional state between resistance and sensitivity. Metallo etalactamases are sorted as group three enzymes because they have the ability to hydrolyse penicillins, cephalosporins and carbapenems, but are highly resistant mainly to all well known β-lactam inhibitors (Bush, Jacoby, & Medeiros, 1995). These enzymes manufacturing is mainly constitutive (Majiduddin, Materon, & Palzkill, 2002). They have identified Class B metallo etalactamases in both Gram positive and Gram negative bacteria. They are found in many clinically important species such as Acinetobacter spp. and Pseudomonas aeruginosa. The most popular Class B β-lactamases was belonging to the IMP and VIM families (Majiduddin et al., 2002). These enzymes are classified into three functional subgroups, B1, B2 and B3, depending on metal requirements. In subclass B1, it contains a lot of metallo etalactamases, it was revealed that Zn1 is coordinated very tightly and Zn2 is coordinated very loosely (Fabiane et al., 1998). The B3 subgroup contains a Zn1 site that binds zinc molecule very firmly (Valladares et al., 1997).

Materials and Methods

The two hundred and fifty clinical specimens were submitted for bacteriological testing from hospitalized inpatients admitted to Kasr Al Aini Hospital (KAA) and Al-Demerdash Hospital (ADH), Egypt in the period from February 2016 till December 2017 and one hundred and forty five samples revealed Pseudomonas aeruginosa. The details of the collected isolates are shown in Table 1.

Phenotypic methods

Isolates Culture and Identification

The provided two hundred and fifty clinical isolates were subcultured on Nutrient Agar, 10% sheep blood agar and MacConkey’s agar supplied from (Oxoid Ltd, Basin Stoke, Hants, England). The clinical samples which confirmed P.aeruginosa was preserved for further use by being subcultured weekly on MacConkey’s agar and stored for short period maintenance in the refrigerator at 4°C. Then the isolates were frozen at -80°C for long term use in glycerol medium. The one hundred and forty five P. aeruginosa isolates were identified using the conventional methods done by Monica Cheesbrough on the basis of Gram staining, motility, pigment production, catalase test, characteristic colony morphologies on MacConkey’s agar and oxidase reaction (Cheesbrough, 2006).

Antimicrobial Susceptibility Testing (Disk Diffusion Method)

The antimicrobial susceptibility testing of one hundred and forty five P.aeruginosa strains were determined, according to Bauer and Kirby 1997. The following antibiotics were used, ampicillin 10 µg (AMP¹⁰), ampicillin/sulbactam 20 µg (SAM²⁰), trimethoprim/sulphamethoxazole 25 µg (SXT²⁵), imipenem 10 µg (IPM¹⁰), ciprofloxacin 5 µg (CIP⁵), gentamicin 10 µg (CN¹⁰), levofloxacin 5 µg (LEV ⁵), polymyxin B300 U (PB³⁰⁰), ceftriaxone 30 µg (CRO30) and tetracycline TE 30 µg (TE³⁰). They were supplied from (HiMedia). The culture was done by making a saline suspension of the isolated colonies selected from an 18-24 hrs nutrient agar plate. The zone diameter was recorded for the previously mentioned antibiotics and the results were interpreted according to the Clinical and Laboratory Standards Institute (CLSI 2017) and then a screening of the heteroresistant strains of resistant P.aeruginosa was recorded.

Determination of the antibiotics minimum inhibitory concentrations (MIC)

Out of one hundred and forty five P.aeruginosa strains, forty three heteroresistant clinical isolates were determined from resistant ones for ampicillin, ampicillin/sulbactam, ceftriaxone, ciprofloxacin, gentamicin, levofloxacin, polymyxin B, sulphamthoxazole/trimethoprim and tetracycline powder supplied from (Himedia) using the agar dilution technique according to the procedure recommended by the NCLSI and the results were interrupted according to CLSI 2017 M100.

Each antibiotic was diluted two-fold dilution in Petri dishes using inoculums of 1*10⁶ cfu/ml and incorporated into 19 ml of MHA to create a series of plates ranging from 64 to 0.015 mg/liter and the final inoculum chosen was 5 μl of a 1:25 dilution of the 0.5 McFarland standard suspensions. The plates were then incubated at 37˚C for 24hours. After incubation, the growth of microorganism is considered positive or negative (if number of CFU ≥ 1).

Polymerase Chain Reaction to detect the metalloβ-lactamase genes in the heteroresistant isolates

DNA isolation was done using (QIAmp DNA, England mini kit) according to manufacturer instructions, the following components were pipetted in a sterile clean PCR tube: 25 µl of 2X PCR Master Mix (Vivantis, Malayzia), 1 µl of Forward primer, 1 µl of Reverse primer, gemonic DNA with 100 ng concentration and nuclease free water up to 50 µl, the sample tubes were mixed gently, spun and placed in (BEOCO Germany thermal cycler). The primers were initially denaturated at 95°C for 5 minutes for 1 cycle. Denaturation continued at 95 °C for 45 seconds, then annealing at 56 °C for 45 seconds and extension at 72 °C for 45 seconds for 35 cycles. The final extension was done at 72°C for 10 minutes for 1 cycle. The primers used were demonstrated in (Table 2). The agarose gel was prepared by melting 2 grams of agarose powder into 100 ml of 1X TAE electrophoresis buffer, then the ethedium bromide solution (0.5 µg/ ml) was added to the melted agarose when the temperature was about 65°C and then mixed thoroughly. After that, the melted agarose was poured on the gel casting apparatus after proper installation of the desired comb, the gel was allowed to solidify at room temperature. The electrophoresis chamber was filled with 1X TAE buffer. The PCR products (10 µl of PCR product+ 2 µl of loading dye) and molecular weight marker were loaded, the tank was then closed and the power supply was applied using 5 volts /cm of the tank length. Then the run was stopped when the bromophenol blue reached 2/3 of the gel length. The gel was visualized on a UV transilluminator and photographized using a camera.

Sequencing

The DNA sample was run on agarose gel electrophoresis to separate DNA fragments. Agarose gel band containing the desired DNA was cut and placed into a pre-weighed micro-centrifuge tube. The tube was centrifuged briefly to make sure the gel slice stayed at the bottom of the tube. Incubation at 50°C until the gel had melted completely. One gel volume of absolute ethanol was added to the solubilized sample and mixed thoroughly. The tubes were centrifuged at 10,000 xg for 1min. The flow-through was discarded. Then in the column washing, the column was washed with 650µl Wash Buffer and sample were centrifuged at 10,000 xg for 1min.

The column was then dried by being centrifuged at 10,000 xg for 1min to remove any residual ethanol. Finally, the column was placed into a clean micro-centrifuge tube for DNA elution. A 30-200µl of Elution Buffer was added directly onto the column membrane and stood for 2min. The tube was spun at 10,000xg for 1 min to elute DNA. DNA was stored at -20°C. Sequencing of the PCR products were done in ABI Prism Applied Biosystems HITACHI-3130XL Genetic Analyzer using BigDye Terminator v3.1 Cycle Sequencing Kit Applied Biosystems.

Statistical Analysis

Data generated in this study were analyzed using statistical software (SPSS version 20.0) for the test of significance. Results were presented as percentages. Relationships at a p-value of less than or equal to 0.05 (P≤ 0.05) was considered statistically significant.

Results and Discussion

Identification and confirmation of samples

The one hundred forty five isolates revealed P.aeruginosa had shown positive morphological characters on MacConkey’s agar, Gram stain, motility, pigment production, catalase test and oxidase test.

The Antimicrobial Susceptibility Testing using the KB method

The susceptibility testing results and the antibiotics sensitivity pattern of P.aerugenosa isolates were shown (Figure 1). Screening of heteroresistance in resistant P.aeruginosa clinical isolates had shown the detection of one forty three. Our study was done to detect the heteroresistance and have reported that the prevalence may be due to differences in the study population, the number of specimens, exposure to broad spectrum antibiotics and contact with hospital settings. Analysis of the results showed varying degrees of resistance among isolates. The isolates exhibited the highest resistance pattern to ceftriaxone and ampicillin and lowest to levofloxacin and imipenem. This may be due to the hazardous use of ampicillin because they are well known between most of the people in Egypt and being highly used and recommended. Heteroresistance is a particular kind of bacterial resistance and the researcher's concern increased greatly with this kind of resistance because it can lead to clinical detection error and an antiinfection failure, heteroresistance detection was early studied on Staphylococcus aerus as first discovered methicillin-heteroresistant Staphylococcus aerus isolates taken from a patient who suffers from infectious disease (Chabbert, 1967). Many countries until now have mentioned the vancomycin heteroresistant Staphylococcus aerus (Campanile et al., 2010). A certain recent study had revealed the Acinetobacter Baumanni to polymyxin B and carbapenem (Ikonomidis et al., 2009; Pournaras, Ikonomidis, Markogiannakis, Maniatis, & Tsakris, 2005; Yau et al., 2009). Few researchers have proven heteroresistance of P.aeruginosa to meronopem (Gordon & Wareham, 2009). In this study, we used KB antimicrobial susceptibility method and forty three samples showed heteroresistance. The heteroresistant isolates were very high to ampicillin, where thirty-six isolates revealed high heteroresistance to this antibiotic and heteroresistance to levofloxacin was only one isolate. From the varying results of the heteroresistance, we observed that heteroresistance of P.aeruginosa must be paid more attention in the future and most probably that the high resistance of P.aeruginosa to most of carbapenems antibiotics is due to the presence of metallo β-lactamases and the abnormal expression of efflux pump. The hazardous use of carbapenems antibiotics in Egypt may lead to high resistance. In another study of P.aeruginosa to imipenem, they observed the sensitivity of one hundred and forty strains of P.aeruginosa to imipenem using the KB method and VITEK method and our results agreed with them. In a certain study carried out in Sapain to determine the antimicrobial susceptibility testing of P.aeruginosa isolated from children faces on different antibiotic, they revealed that the antimicrobial resistance pattern was as follows for ciprofloxacin (1%), imipenem (1%), gentamicin (3%), aztreonam (7%), cefepime (7%) and ceftazidime (8%) (Schelin, Wallin-Carlquist, Cohn, Lindqvist, & Barker, 2011). We agreed with the high susceptibility to imipenem, ciprofloxacin and gentamicin. Their results were reported to be contrasted with the multidrug resistant P.aeruginosa detected in studies carried out with clinical strains (Balasubramanian, Harper, Shopsin, & Torres, 2017).

In another study, they proved that combining these two mechanisms is the most likely explanation for the universal resistance of the isolates to tetracycline and chloramphenicol. Intrinsic resistance of P.aeruginosa to the folic acid synthesis inhibitor, co-trimoxazole, has been reported to its impermeability and the expression of the efflux pump MexAB-OprM (Köhler et al., 1996). They reported that all of the isolates were resistant to the aminoglycoside antibiotics (spectinomycin, paramomycin, kanamycin, neomycin and hygromycin B).

We have found that our results agreed with them. Future studies should be done to make effective combinations of the previously mentioned antibiotics to accelerate the recovery and shorten the duration of the illness period. To detect the imipenem heteroresistant strains, they used the double disk synergy test and SYBGreen RT-PCR for efflux pump (Huang, Siehnel, Bellido, Rawling, & Hancock, 1992; Pirnay et al., 2002), in their study, they confirmed twenty imipenem heteroresistant strains and demonstrated that the imipenem resistant mechanism of P.aeruginosa is compromised with the high MexAB expression of efflux pump, P.aeruginosa can go away from the bacterial membrane and resistance occur (Huang et al., 1992; Pirnay et al., 2002). They made PCR to detect the metallo β-lactamases, but not detected in the twenty heteroresistant ones.

Minimum Inhibitory Concentration

MIC of antibiotics of heteroresistant P.aeruginosa clinical isolates were detected in (Table 3). The heteroresistant strains were forty three isolates and the test was done on all the used antibiotics and the results were interpreted from Pseudomonas aeruginosa non Enterobacteriaceae; (Zone Diameter Interpretative Standards and equivalent MIC Breakpoints) of the CLSI M100-2017 27^th edition.

In this study, MIC was done on the heteroresistant P.aeruginosa resistant clinical isolates. It was reported that, for Ampicillin, all the forty three heteroresistant isolates were resistant to Ampicillin, showing MIC results ≥ 32 µg/ml. For Imipenem, forty one samples were sensitive, showing MIC results ≤ 2 µg/ml and two samples only were resistant, showing MIC results ≥ 8 µg/ml. MIC results. In a certain study, they have observed the occurrence of multiple subpopulations and the MIC for the most highly resistant subclones, although, they have found that the heterogeneous sub populations had their resistance levels conferring a stable and the same expression of the heteroresistant phenotype to vancomycin in Enterococci (Alam et al., 2001). P.aeruginosa heterogeneously carbapenem has given a new protocol in the treatment to inhibit P.aeruginosa mutants resistance, optimizing the administration of meropenem has been recently reported (Tam et al., 2005).

Polymerase Chain Reaction Results

PCR was done for the heteroresistant clinical isolates, SIM gene was represented in (Figure 2). SPM gene was represented in (Figure 3) and the IMP gene was represented in (Figure 4).

In our study, PCR was done to detect the metalloβ-lactamases and we have found that the three genes were detected in the heteroresistant isolates and this confirmed the high resistance of the heteroresistance isolates to the penicillins. A certain study was carried out in Egypt revealed that 33 of 48 (68.7%) carbapenem resistant P.aeruginosa isolates produced MBL, their study demonstrated the presence of MBL producing P.aeruginosa was 82% (Diab, Fam, El-Said, El-Defrawy, & Saber, 2013). VIM-2 was the most prominent gene detected among the different MBL genes, their results were conferred to be the same as other results performed on previous studies to confirm that was VIM-2 the most frequently distributed MBL implicated in imipenem resistant P.aeruginosa (Walsh, Li, Toleman, Bennett, & Jones, 2008). In another Egyptian study, they reported the presence of 32.3% MBL (Mansour, Eldaly, Fatani, Mohamed, & Ibrahim, 2013). In our study, we confirmed that the IMP gene was a highly significant gene. In another study that was done in Nepal to detect MBL genes, the VIM gene was the most frequently detected one (75%) and the IMP gene was (25%), their results agreed with previous studies in Kinea, revealing that the VIM gene is the most common MBL genes responsible for decreased susceptibility to imipenem (Pitout et al., 2008). In our study, we found IMP genes in twenty five isolates out of forty three heteroresitant ones (59%).

Sequencing results

SIM gene sequences

TACAAGGGATTCGGCATCGTTAAAAAACAAGGCTT

AGTAGTTCTTGACAATCACAAGGCATATCTCATCGA

CACTCCAGCTTCCGCAGGAGATACTGAAAAGCTAGT

AAACTGGCTCGAAAAAAATGATTTCACTGTCAATGG

AAGCATTTCAACACATTTCCACGACGACAGTACTGCT

GGGATAGAGTGGCTTAATACAAAGTCCATCCCCACATA

TGCATCTAAATTGACAAATGAATTGCTAAATAAAAATGG

CAAAACTCAAGCCAAGCACTCTTTTGATAAAGAGAGCT

TTTGGTTGGTCAAAAATAAAATTGAAATTTTTTATCCAG

GCCCAGGACACACTCAAGATAACGAAGTTGTCTGGATAC

CTAATAAAAAAATCCTATTCGGGGGCTGTTTTATAAAAC

CGAATGGCCTTGGCAATCTAAGTGACGCAAATTTGGAAG

CTTGGCCAGACTCCGCAAAAAAAATGATATCAAAATACA

GTAAGGCAAAACTTGTTATCCCAAGCCACAGTGAAATCG

GAGACGCATCACTATTGAAACTCACATGGGAACAGGCCATTA

SPM gene sequences

AAAATCTGGGTACGCAAAGGCTTATGGATTGGGTGGCT

AAGACTATGAAGCCGAAGAAAGTAGTAGCCATCAATAC

GCACTTTCATTTGGACGGCACGGGTGGAAATGAAATTT

ACAAGAAGATGGGCGCGGAGACGTGGTCGAGCGATCTG

ACAAAGCAGTTGCGACTTGAGGAAAACAAGAAAGACCG

GATAAAAGCAGCTGAGTTCTATAAAAACGAGGATCTGAA

GCGAAGGATTCTGAGTTCCCATCCTGTTCCAGCGGATAAT

IMP gene sequences

Ggaatagagtggcttaattctcgatctatccccacgtatgcatctgaattaa

caaatgaactgcttaaaaaagacggtaaggttcaagccacaaattcattta

gcggagttaactattggctagttaaaaataaaattgaagttttttatccagg

cccgggacacactccagataacgtagtggtttggctgcctgaaaggaaa

atattattcggtggttgttttattaaacc

Statistical Analysis Results

In this study, a screening of hetreoresistance of resistant P.aeruginosa isolates was performed according to antimicrobial resistance profile and metalloβ-lactamase genes. The distribution of heteroresistance in the antibiotics profile was determined and the results were convenient as the obtained results and imipenem will be recommended to be the drug of choice in the treatment of the heteroresistant strains of the resistant Pseudomonas aeruginosa, followed by levofloxacin, then ciprofloxacin and finally gentamicin, the results were represented in (Figure 5).

Conclusions

The study of the sensitivity pattern of heteroresistant strains of resistant P.aeruginosa against different antibiotics was detected and it was found that P.aeruginosae isolates were highly sensitive to imipenem. We have found that the IMP metalloβ-lactamase gene is a highly significant distributed gene.